The search box accepts several inputs. For instance, one can use a gene identifier among the following:
- EnsEMBL identifier (e.g., ENSG00000108654)
- Gene name (e.g., Optineurin)
- Official symbol or synonyms (e.g., DDX17)
Alternatively, chromosomal positions that follow the format below are accepted.
- chrX:Start-End:Strand (e.g., chr7:55086714-55324313:1)
Ultimately, it is also possible to input a sequence and the program will look for the corresponding gene(s).
- At least 25 nucleotides (e.g., CGCCTTGACAACGTCACAGTGGCAC)