FasterDB

How to look for a gene?

The search box accepts several inputs. For instance, one can use a gene identifier among the following:

• EnsEMBL identifier (e.g., ENSG00000108654)
• Gene name (e.g., Optineurin)
• Official symbol or synonyms (e.g., DDX17)

Alternatively, chromosomal positions that follow the format below are accepted.

• chrX:Start-End:Strand (e.g., chr7:55086714-55324313:1)

Ultimately, it is also possible to input a sequence and the program will look for the corresponding gene(s).

• At least 25 nucleotides (e.g., CGCCTTGACAACGTCACAGTGGCAC)

Your search did not return any results. Try again with a different input or have a look at the help section.